quinn-loves-liam - [insert meme here]
[insert meme here]

21, any pronounds really but i prefer they/them or he/him. Proud posessive polyamorous pansexual person.

284 posts

Latest Posts by quinn-loves-liam - Page 3

3 years ago

Articles I can use against truscum

4 years ago

Hey Plauntie, I've a question! A lot of mutuals I've got here are saying that asexuals aren't really LGBT+ if they're cis/het and that pan people are biphobic. I don't really understand this so I figured a good person to ask about this is you rather than accept what they're saying at face value since it seems exclusionist to what I thought beforehand.

Well the thing is, ace people aren’t heterosexual. Hererosexuality means sexual attraction to the opposite gender, and the whole thing with acesexuality is that you don’t experience sexual attraction. So that means, by definition, that ace people aren’t heterosexual.

I dunno why that fact is so hard for aphobes to wrap their heads around tbh.

And pan people aren’t biphobic, that’s ridiculous. Bisexual is being attracted to more than one gender. Pansexuality is attraction to people regardless of gender.

Quite honestly, sounds like a lot of your mutuals are kinda shitty excursionists tbh.

4 years ago
Happy Pride To The Creator Of The "gay People I Respect" Meme
Happy Pride To The Creator Of The "gay People I Respect" Meme

Happy pride to the creator of the "gay people i respect" meme

4 years ago

Incase anything happens to my account here’s my entire genome:

GATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGYTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTAOCGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHUATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTCKAATCAATCCTCHATCTNACCCCCTTTAFCOGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTAFCGATCCCGTAGWGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTGATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGIAGGGTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGHCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTACGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCACGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTDCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATOCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCHATCTACCCCCTTTAFCGATCCCGDTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCATCTACCCCCTTTAFOCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCCTTTAFCGATCCCGTAGGGTIAGGATCCTCATCTACCTCTTCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAOATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCETCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTMTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGG…

4 years ago

Leak the fight club letterboxd list

Leak The Fight Club Letterboxd List
4 years ago

p- pie- pirate

Doing An Art Trade With @xbobatea I Hope You Like It!!! ^^

doing an art trade with @xbobatea I hope you like it!!! ^^

4 years ago
The Steam Summer Sale Is Upon Us Once Again Folks!!!

the steam summer sale is upon us once again folks!!!

but not just portal 1 and 2! EVERY valve game is 80% off right now! (excluding the ones that are already free) if you’ve been wanting to get into half life or left 4 dead, nows the time! you can even buy every (every.) valve game in a bundle right HERE!

4 years ago

people wanna talk about "don't self diagnose autism" meanwhile the autism test is damn near 3k dollars, a lot of people don't believe women can have autism, and (for black people) doctors don't believe them when they say they have literally anything. so.

4 years ago
YESSSSSSSSSSSSSSSSSSSSSSSSS

YESSSSSSSSSSSSSSSSSSSSSSSSS

4 years ago

EEEEEEEEEEEEEEEEEEEEE i look cool!!!!!!!!!!!!!!

Dumpling And Teddy Bear

Dumpling and teddy bear

mun of @big-dicked-heisenberg and heisenberg 💗

4 years ago
Have Some Gay Dads Happy Pride Month Everybody

have some gay dads happy pride month everybody

4 years ago

they should invent water for men

4 years ago

Twitter you dumb fuck.

Boycotting mcc because Technoblade is in it? It's a charity event, his chat is known for being rich! Also, why would he participate in a LGBT+ charity event if he is homophobic? Are you still looking for an apology for the 5 year old tweet after doxxing and harrassing him off your platform?

Boycotting mcc because no lesbians / trans people? There is actually trans people in this mcc, can you please do research? Also, the members of this specific mcc was handpicked by youtube gaming, because they needed to find people without twitch contracts / can stream on youtube? It is not Scott's fault?

+ 'Then don't partner with Youtube' Youtube gaming is donating 100k in the name of mcc.

Doing a dream team mcc watch party on the same day to boycott mcc? This is just shitty behaviour, you pissed your favorite cishet white boy isn't in this mcc? You complain about no representation then ask why more cishets are not included?

I wish scott smajor a very happy mcc. The man deserves better

4 years ago
Important Updates From Home

Important updates from home

4 years ago

Whenever I do worldbuilding I try to keep this image in mind

Whenever I Do Worldbuilding I Try To Keep This Image In Mind
4 years ago
Suddenly Struck With Intense Desire To Carve Little Things Out Of Wood
Suddenly Struck With Intense Desire To Carve Little Things Out Of Wood

suddenly struck with intense desire to carve little things out of wood

4 years ago

Where do you see yourself in 5 years?

Look buddy, i’m just trying to make it to Friday.

4 years ago
Batman: The Movie (1966) Dir. Leslie H. Martinson
Batman: The Movie (1966) Dir. Leslie H. Martinson

Batman: The Movie (1966) dir. Leslie H. Martinson

4 years ago
So I Found This Caterpillar On My Way To Class
So I Found This Caterpillar On My Way To Class
So I Found This Caterpillar On My Way To Class

So I found this caterpillar on my way to class

We’re bros

4 years ago

Omg omg can u make the snom soft bodies?? I wanna see em plop n jiggle

here they come! here they come!

Omg Omg Can U Make The Snom Soft Bodies?? I Wanna See Em Plop N Jiggle
4 years ago

ya’ll so valid i almost hit like to try and double validate before i read the full thing, so glad i read it all first

reblog if you think heterosexual and/or heteroromantic aces/aros are valid members of the lgbtq+ community

like if you don’t

4 years ago

god my friend’s nsfw gif of karl and an anon getting fucked got stolen by this rando https://twitter.com/B4byAlyx?s=09 please report it

4 years ago

a few reminders because i’m tired and angry

fandom is a hobby, not a form of activism

adult women aren’t inherently creepy for being in fandom and having hobbies apart from raising babies and doing taxes

the vast majority of people pushing back against the worrying trend of instigating harassment over fictional characters and relationships aren’t incest supporters or pedophiles, actually

liking a m/f ship doesn’t make someone a dirty heterosexual invading your space

preferring gay ships doesn’t make you ‘’woke’’ and good

no one owes you a disclaimer that they are a good person who recognizes that their favorite fictional villain’s actions are evil and that they don’t condone those actions irl

liking a fictional villain is in no way comparable to advocating abuse/murder/genocide/etc and you’re a fucking idiot if you believe that

just because a woman is attracted to a fictional villain doesn’t mean she’s promoting toxic relationships or going to end up in a toxic relationship. assuming women can’t tell fiction and reality apart stinks of internalized misogyny 

some rando’s a/b/o fanfics have none of the level of influence that popular tv shows and movies spreading propaganda have

no one owes you a detailed description of their traumas and mental health problems

abusive relationships are not the same as enemies to lovers ships

y’all need to chill the fuck out over people, relationships, actions and events that don’t actually exist and learn how to enjoy and discuss them like normal people

fandom is a hobby, not a form of activism

feel free to add more

4 years ago

love this idea

In terms of RE8 DLC, the content really depends on Capcom’s intention. Like if they wanted to make a sort of fanservicey celebration of the success of Village, then yeah I could see a DLC focusing on the villains that would elaborate on their backstories and lore-building. But if the DLC is meant to bridge a gap between 8 and 9, then I would not be surprised if it solely focuses on Chris, the BSAA, and/or Rosemary. If the DLC story focuses on the four lords, I would love for them to use Ada Wong to explore the village from a different, more knowledgable lens. Or possibly put the player into the shoes of a villager who is being experimented on - who maybe has to escape from the different lords while slowly turning into a lycan after the Cadou implantation. 

4 years ago
Wisdom If I’ve Ever Seen It

Wisdom if I’ve ever seen it

4 years ago

i am so so sick of white gay ppl trying to make antiracism movements about them like if i see one more motherfucker on tiktok respond to a pocs video with the FUCKING “uwu but i have adhd and im gay / trans how can u say im not oppressed” like shut up this is not about u and just because u are queer does not negate the fact that you benefit from white privilege stay in your fucking lane and check urself 

Explore Tumblr Blog
Search Through Tumblr Tags